{"annotations": [{"id": 7327044, "ns": "openmicroscopy.org/mapr/gene", "name": null, "description": null, "owner": {"id": 2}, "date": "2017-01-17T11:31:35+00:00", "permissions": {"canDelete": false, "canAnnotate": false, "canLink": false, "canEdit": false}, "link": {"id": 27312830, "owner": {"id": 2}, "parent": {"id": 3125701, "class": "ImageI", "name": "1.tif"}, "date": "2017-01-17T11:31:35+00:00", "permissions": {"canDelete": false, "canAnnotate": false, "canLink": false, "canEdit": false}}, "class": "MapAnnotationI", "values": [["Gene Identifier", "AT1G02720"], ["Gene Identifier URL", "http://arabidopsis.org/servlets/TairObject?type=locus&name=AT1G02720"], ["Gene Symbol", "GATL5"]]}, {"id": 7327045, "ns": "openmicroscopy.org/mapr/gene/supplementary", "name": null, "description": null, "owner": {"id": 2}, "date": "2017-01-17T11:31:35+00:00", "permissions": {"canDelete": false, "canAnnotate": false, "canLink": false, "canEdit": false}, "link": {"id": 27312833, "owner": {"id": 2}, "parent": {"id": 3125701, "class": "ImageI", "name": "1.tif"}, "date": "2017-01-17T11:31:35+00:00", "permissions": {"canDelete": false, "canAnnotate": false, "canLink": false, "canEdit": false}}, "class": "MapAnnotationI", "values": [["Reagent Design Gene Annotation Build", "TAIR10"], ["Analysis Gene Annotation Build", "TAIR10"], ["Glycosyltransferase Family", "GT8"], ["Forward Primer Sequence (5' - 3')", "CATGCGAAATGTGCCTCTCA"], ["Reverse Primer Sequence (5' - 3')", "CGGAGGAAGAGAACCAAGCT"]]}, {"id": 7326957, "ns": "openmicroscopy.org/mapr/organism", "name": null, "description": null, "owner": {"id": 2}, "date": "2017-01-17T11:31:29+00:00", "permissions": {"canDelete": false, "canAnnotate": false, "canLink": false, "canEdit": false}, "link": {"id": 27312039, "owner": {"id": 2}, "parent": {"id": 3125701, "class": "ImageI", "name": "1.tif"}, "date": "2017-01-17T11:31:29+00:00", "permissions": {"canDelete": false, "canAnnotate": false, "canLink": false, "canEdit": false}}, "class": "MapAnnotationI", "values": [["Organism", "Arabidopsis thaliana"]]}, {"id": 7326943, "ns": "openmicroscopy.org/mapr/phenotype", "name": null, "description": null, "owner": {"id": 2}, "date": "2017-01-17T11:31:29+00:00", "permissions": {"canDelete": false, "canAnnotate": false, "canLink": false, "canEdit": false}, "link": {"id": 27311730, "owner": {"id": 2}, "parent": {"id": 3125701, "class": "ImageI", "name": "1.tif"}, "date": "2017-01-17T11:31:29+00:00", "permissions": {"canDelete": false, "canAnnotate": false, "canLink": false, "canEdit": false}}, "class": "MapAnnotationI", "values": [["Phenotype", "gene expressed in spots along with general signal in apex of shoot apical meristem"]]}, {"id": 7327046, "ns": "openmicroscopy.org/omero/bulk_annotations", "name": null, "description": null, "owner": {"id": 2}, "date": "2017-01-17T11:31:35+00:00", "permissions": {"canDelete": false, "canAnnotate": false, "canLink": false, "canEdit": false}, "link": {"id": 27312834, "owner": {"id": 2}, "parent": {"id": 3125701, "class": "ImageI", "name": "1.tif"}, "date": "2017-01-17T11:31:35+00:00", "permissions": {"canDelete": false, "canAnnotate": false, "canLink": false, "canEdit": false}}, "class": "MapAnnotationI", "values": [["Organism Part", "shoot apical meristem"], ["Ecotype", "Col-0"], ["Genotype", "wild type genotype"], ["Experimental Condition [Target Gene]", "AT1G02720"], ["Channels", "RGB"], ["Image File Type", "raw"], ["In Situ Section", "serial section I"], ["Expression Pattern", "Type 4, spots along with general signal in apex"], ["Has Phenotype", "yes"], ["Phenotype Annotation Level", "gene"]]}], "experimenters": [{"id": 2, "omeName": "demo", "firstName": "Public", "lastName": "data"}]}